You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
tsaE [2020-10-13 17:26:40]
protein kinase, required for threonyl carbamoyl adenosine (t6A) modification of tRNAs that pair with ANN codons in mRNA
Molecular weight
17.76 kDa
Function
control of tRNA modification
Product
protein kinase involved in tRNA modification
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
641,654 → 642,130
Phenotypes of a mutant
reduced growth rate PubMedincreased sensitivity to paraquat PubMed The protein
Catalyzed reaction/ biological activity
biosynthesis of the threonylcarbamoyladenosine (t6A) residue at position 37 of ANN-decoding tRNAs using L-threonylcarbamoyl-AMP (TsaB-TsaD-TsaE) PubMedautophosphorylation on Ser-60, Thr-55, Thr-62, and Thr-64 PubMedphosphorylation of TsaD PubMed Protein family
TsaE family (single member, according to UniProt)Kinetic information
K(M) for ATP: 60 myM, V(max) 10 nmol/min PubMed Modification
autophosphorylation on Ser-60, Thr-55, Thr-62, and Thr-64 PubMed Cofactors
Structure
Localization
cytoplasm with the exception of the nucleoid region PubMed Additional information
ATPase activity is required for in vivo function of the protein PubMed Expression and Regulation
Biological materials
Mutant
BKE05910 (ΔtsaE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TTGCTTCACACGAGTCACCC, downstream forward: _UP4_ATGCTTTGTGAGGAGTTAAGBKK05910 (ΔtsaE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TTGCTTCACACGAGTCACCC, downstream forward: _UP4_ATGCTTTGTGAGGAGTTAAG Expression vectors
for expression/ purification from B. subtilis with N-terminal Strep-tag, for SPINE, in pGP380: pGP833, available in Stülke labfor expression/ purification from E. coli with N-terminal His-tag, in pWH844: pGP841, available in Stülke lab References
Loading